jimtrue.com : school : CJT2260 : 2003-10-30: DNA Study Gudes (Web & Textbook)

Posted by Jim True on November 3, 2003 8:04 AM. Last Updated October 22, 2006 9:23 PM

Disclaimer for all material noted here is at the bottom of this web page.

2003-10-30: DNA Study Gudes (Web & Textbook)

As promised, answers to study guide are NOW posted.

DNA Interactive http://www.dnai.org

  1. What molecule did Miescher discover? A white precipitate called Nuclein
  2. Why is genetic material known as DNA? Because of its sugar structure (ribose based) and it's acidic nature.
  3. What is the DNA molecule made of? Four different nucleotides, ribose sugar, and phosphate.
  4. What is the "Central Dogma"? Since DNA resides in the Nucleus and cell replication occurs in the Cytoplasm, he believed DNA must use a carrier molecule to transmit information to the proteins.
  5. What is the carrier molecule that "transmits" info from DNA to proteins? Messenger RNA
  6. How is RNA different from DNA? (3 ways) It is made of ribose instead of deoxyribose. It has the nucleotide urasil as opposed to thymine. It is a single strand molecule, not a double-strand.
  7. What is the function of polymerase? an enzyme that 'binds' the base pairs together in the two strands of a DNA molecule.
  8. What is the function of ligase? In the process of Recombinant DNA (rDNA) ligase is used to 'glue' a separate strand of DNA into a piece of DNA that has been cut with a restriction enzyme.
  9. What are the three models of replication? Semi-Conservative, Conservative and Dispersive
  10. Which of these models depicts the way DNA replicates itself? Semi-conservative, meaning the 2 daughter DNA's are created by one strand of the original and a replicated copy.
  11. If less than 4 nucleotides are present, can DNA replication occur? No, all four nucleotides must be present in order for DNA to replicate.
  12. How many different amino acids are known as of today? 20
  13. A sequence of how many bases is needed to produce a protein? 3

http://www.howstuffworks.com/dna-evidence.htm

  1. How much of a person's genome is different from anyone else's? 0.10 percent or approximately 3 million base pairs
  2. Genes make up what percentage of the human genome? 5 percent of the human genome
  3. Non-coding regions make up what percentage? 95 percent of the human genome
  4. What is the role of a restriction enzyme? to cut a lenght of DNA into short manageable fragments by recognizing specific four to six base sequence and reliably cleave DNA at a specific base pair within this span

This sequence is found on one strand of a DNA molecule. Underneath, fill in the appropriate nucleotides (the complementary base-pair):

ATGCGCGTACGTGATTACAAAAGACCTGTCAATGG


Match A-T, T-A, C-G and G-C

This sequence represents a strand of DNA that is being transcripted into mRNA. Underneath, fill in the appropriate nucleotides:

ATCGGCTTTAGCGCTAAATCGCGTAAAAGTTTTGT


Since this is mRNA use Urasil where you would use Thymine. Match A-U, T-A, C-G and G-C

DNA Study Guide Text

  1. What was Mendel's major intellectual contribution to the study of genetics? (p 221) Demonstrated that material basis of inheritance was particulate and that mixing did not alter genes.
  2. What is a gamete? (p222) cells that only contain HALF of the DNA that makes the parent unique (sperm and ova for humans)
  3. What is the difference between genotype and phenotype? (p222) phenotype is a possible characteristic (like hair or eye color or blood type); genotype are the possible combinations within that phenotype.
  4. What does RFLP stand for? Restriction Fragment Length Polymorphisms Who developed this technique for the individualization of biological fluids? (p226) Alec Jeffreys in 1975
  5. The human genome contains about how many base-pairs? (p227) 3 billion
  6. Name the bases. How do they pair up? (p227, 232) Adenine and Thymine, Guanine and Cytosine, A-T and G-C
  7. What enzymes are responsible for most of the environmental breakdown of DNA? (p230) Nucleases
  8. The shape of DNA is best described as a double-helix (p232)
  9. What is denaturation? (p232) heating one DNa molecule to greater than 95 degrees celsius to break the link apart along the bases.
  10. What are the 3 steps in copying DNA (simplified?) (p233) 1. obtain a single strande of of double-stranded DNA. 2. split it into separate strands (templates) along the bases. 3. synthesize new complements from the templates.
  11. What does PCR stand for? (p233) Polymerase Chain Reaction
  12. Who was awarded the '93 Nobel Prize for developing PCR? (p233) Kary Mullis
  13. Copying DNa via PCR is an exponential process. What does this mean? (p233) From one set you get two copies, and from each of those two copies you get two copies, etc. so the number of new copies increases exponentially.
  14. What are the three major steps in PCR? (p234) denaturing - heating to split the DNA, annealing - binding primers to the denatured single strands to select a specific sequence to copy, and extension - replication with a thermostable polymerase to duplicate and extend the single strand templates along the primer
  15. The copies of DNA that PCR produces are known as amplicons (p235)
  16. What does STR stand for? (p238) Short Tandem Repeats
  17. Where is mtDNA found in cells? (p242) Within the Mitochondria
  18. How is mtDNA inherited versus DNA? (p242) mtDNA is only passed to the child from the mother; DNA is inherited from both parents.
  19. What are the polymorphic regions of mtDNA called? (p242) Hypervariable regions
  20. mtDNA sequences are compared to a standard sequence called the Anderson sequence. (p243)

Disclaimer: These are MY notes taken from classroom lectures while I'm in the classroom. While I'm perfectly happy to share my notes with my classmates and I know I take very good notes, you should still make every effort to attend the class and TAKE YOUR OWN NOTES. I will not transcribe everything the instructor says in the classroom, and I will NEVER post pre-exam reviews. My notes will not replace the value of actually attending class and taking your own class notes.I also cannot attest to their accuracy, other than they are what was provided in the lecture; you should not reference my notes as "expert opionion" by any means, and if you notice an error or omission, please do me the favor of e-mailing me with the correction and I will re-post my notes. End of Disclaimer.